86
|
Jackson Laboratory
resource source identifier Resource Source Identifier, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reagent+or+resource+source+identifier+sciscan/pm41818240-369-2-6?v=Jackson+Laboratory Average 86 stars, based on 1 article reviews
resource source identifier - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
86
|
Nacalai
resource source identifier chemicals Resource Source Identifier Chemicals, supplied by Nacalai, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reagent+or+resource+source+identifier+sciscan/pm42030952-121-2-11?v=Nacalai Average 86 stars, based on 1 article reviews
resource source identifier chemicals - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
86
|
Servicebio Inc
resource source identifier mouse anti-ki67 mab servicebio cat#gb121141 Resource Source Identifier Mouse Anti Ki67 Mab Servicebio Cat#Gb121141, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reagent+or+resource+source+identifier+sciscan/pm42309065-274-2-9?v=Servicebio+Inc Average 86 stars, based on 1 article reviews
resource source identifier mouse anti-ki67 mab servicebio cat#gb121141 - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
86
|
Merck & Co
resource source identifier chemicals Resource Source Identifier Chemicals, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reagent+or+resource+source+identifier+sciscan/10__1016_slash_j__isci__2025__113899-368-2-11?v=Merck+%26+Co Average 86 stars, based on 1 article reviews
resource source identifier chemicals - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
86
|
Synthego Inc
resource source identifier oligonucleotides gccgtttaagaagatccctg Resource Source Identifier Oligonucleotides Gccgtttaagaagatccctg, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reagent+or+resource+source+identifier+sciscan/pm37330910-206-2-10?v=Synthego+Inc Average 86 stars, based on 1 article reviews
resource source identifier oligonucleotides gccgtttaagaagatccctg - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
86
|
Eurofins
resource source identifier primer Resource Source Identifier Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reagent+or+resource+source+identifier+sciscan/pm34856120-252-2-10?v=Eurofins Average 86 stars, based on 1 article reviews
resource source identifier primer - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
86
|
Obio Technology Corp Ltd
resource source identifier oligonucleotides Resource Source Identifier Oligonucleotides, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reagent+or+resource+source+identifier+sciscan/pm38382532-187-2-24?v=Obio+Technology+Corp+Ltd Average 86 stars, based on 1 article reviews
resource source identifier oligonucleotides - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
86
|
Fisher Scientific
resource source identifier chloroform fisher scientific bp11451 2 propanol Resource Source Identifier Chloroform Fisher Scientific Bp11451 2 Propanol, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reagent+or+resource+source+identifier+sciscan/pm41105512-233-2-6?v=Fisher+Scientific Average 86 stars, based on 1 article reviews
resource source identifier chloroform fisher scientific bp11451 2 propanol - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
86
|
Affinity Biosciences
resource source identifier rabbit anti- fcer1g affinity biosciences df13263 Resource Source Identifier Rabbit Anti Fcer1g Affinity Biosciences Df13263, supplied by Affinity Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reagent+or+resource+source+identifier+sciscan/10__1016_slash_j__isci__2025__113687-615-33-40?v=Affinity+Biosciences Average 86 stars, based on 1 article reviews
resource source identifier rabbit anti- fcer1g affinity biosciences df13263 - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
86
|
Partek
resource source identifier org mm e g Resource Source Identifier Org Mm E G, supplied by Partek, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reagent+or+resource+source+identifier+sciscan/pm41100252-333-2-11?v=Partek Average 86 stars, based on 1 article reviews
resource source identifier org mm e g - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
86
|
Fine Science Tools
resource source identifier glad press n seal wrap glad 240611 000532 scissor handle forceps Resource Source Identifier Glad Press N Seal Wrap Glad 240611 000532 Scissor Handle Forceps, supplied by Fine Science Tools, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reagent+or+resource+source+identifier+sciscan/pm41528849-97-3-15?v=Fine+Science+Tools Average 86 stars, based on 1 article reviews
resource source identifier glad press n seal wrap glad 240611 000532 scissor handle forceps - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
90
|
Neurostar GmbH
reagent or resource source identifier other neurostar robot stereotax Reagent Or Resource Source Identifier Other Neurostar Robot Stereotax, supplied by Neurostar GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reagent+or+resource+source+identifier+sciscan/pm33296656-334-2-6?v=Neurostar+GmbH Average 90 stars, based on 1 article reviews
reagent or resource source identifier other neurostar robot stereotax - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |